Research Article - International Journal of Pure and Applied Zoology (2017) Volume 5, Issue 1

MOLECULAR IDENTIFICATION OF ROTYLENCHULUS RENIFORMIS (NEMATODA) BY USING ITS REGION OF RDNA

*Corresponding Author:

Swetha sudha N
Department of Zoology, Osmania University
Hyderabad-07, Telangana, India
E-mail: swethanagamalla@gmail.com

Received 18^th November 2016; Accepted 28^th December 2016; Published 10^th January 2017

Abstract

Background: Reniform nematode (Rotylenchulus reniformis) is widely distributed in all cotton (Gossypium spp.) grown regions of India. In Reniform nemotode infection, the growth of cotton roots and shoots was reduced at level of more than 8 and 1 nematode per g soil, respectively. DNA-based Molecular identi?cation of Plant parasitic nematode species has been determined by Internal Transcribed spacer (ITS) gene with PCR Techniques. The ribosomal DNA (rDNA) is a novel genetic marker and it is a multi-gene family consisting of many copies (100-500 in animals) of genes encoding for three ribosomal components 28S, 5.8S and 18S. Phylogeny is the history of organism lineage as they change through time. It implies that different species arise from previous forms via decent and that all organisms from the smallest microbes to the largest plants and vertebrates were connected by the passage by genes along the branches of the phylogenetic tree that links all the life form. In this study we have evaluated the diagnostic utility of the ITS1 and ITS2 region for constructing phylogenetic trees and determining taxonomic identity of Plant parasitic nematode species. Results: Rotylenchulus reniformis was collected from soil and root samples of Cotton crop and from Rotylenchulus reniformis (PPN) the ITS region of rDNA sequence is isolated. Phylogenetic analyses of Neighbor Joining (NJ) was distance based method, in this our sequence Rotylenchulus reniformis and Rotylenchulus reniformis of USA country were formed as one clade. Rotylenchulus reniformis of ITS gene sequence depicting high congruence with Rotylenchulus reniformis of USA country by 100 bootstrap replicate values. Conclusions: The ITS region becomes an important taxonomic feature in nematode identification. ITS versatility, specificity, effort of experimental manipulation, and growing ITS databases should accelerate its application in nematology. Most interesting finding in our studies with reference to plant parasitic nematode and its host plant suggested that ITS gene sequence helps in identifying nematode pest status and host plant susceptibility. Thus, these studies will help us to develop the Integrated Pest Management (IPM) package for a specific host plant and its variety. At the same time ITS supports Quarantine technology with reference to agro product export and import.

Keywords

Internal transcribed spacer (ITS); Phytonematode; Rotylenchulus reniformis; Ribosomal DNA (rDNA)

Introduction

Reniform nematode (Rotylenchulus reniformis) is widely distributed in all cotton (Gossypium spp.) grown regions of India. Traditionally, morphological and morphometric characters have been used to discriminate between nematode taxa, both for diagnostic purposes and to clarify the evolutionary relationships between them (Maggenti, 1991). These diagnostic methods can be time consuming, requiring a lot of skill and expertise (Subbotin et al., 2000). In addition, many taxa can be diagnosed only from adult male or female specific structures, or from population measures of relative morphological characters. In such cases, larvae, individuals of the “wrong” sex or individual specimens may not be identifiable. For many studies, identifications are only made at the generic level, not to named species (Mai and Mullin, 1996; Floyd et al., 2002). Also the nematode control by resistant plants is far more effective than any other alternative. Recently, it has been confirmed that precise genetic identification of plant cultivars and pathogens on both theoretical and practical levels offers a solid scientific platform when measuring host suitability for pathogens. It enables precise understanding of plant/pathogen relationships.

The nucleotide sequences of fragments of rRNA genes have been obtained in various species of plant parasitic nematodes, yielding a proper platform for both identification and taxonomic approaches (Giorgi et al., 2002). Molecular methods for diversity assessment have already aided in the understanding of other groups of organisms that are difficult or impossible to study by any other means (Floyd et al., 2002). There is currently much interest in the use of DNA sequences as markers for taxonomic identification and biodiversity surveys, an approach also known as DNA bar coding (Hebert et al., 2003). The techniques that use universal primers to target microbial genes have significant advantages, e.g., convenience, high-throughput, and considerable savings in time (Puitika et al., 2007); it is a quicker and more efficient way of studying nematode diversity than traditional taxonomic methods, which depend on morphological criteria (Floyd et al., 2002). Also, knowledge of genetic diversity in the case of plant-parasitic nematodes is essential to effective resistance breeding programs for the host (Hahn et al., 1994; Roberts, 2002). Earlier researchers worked on nematodes identification based on ITS sequences, DNA based approaches have been successful used for the molecular diagnostics of Rotylenchulus sp (Vovlas et al., 2008; Atighi et al., 2011; Cantalapiedra-Navarrete et al., 2012). Yet, to the best of our knowledge, there is not a single nematode species that has failed to provide an amplification product of the ITS region when amplified with "universal" PCR primer sets. Universal amplification coupled with the ability to amplify ITS from individual nematodes suggests that any species, population, or ecological community of nematodes can be analyzed using a molecular approach based on the rDNA ITS region (Vrain and McNamara, 1994). Only few sequences available in the primary nucleotide databases span the entire rDNA array, although in several cases phylogenetic relationships within different species of plant-parasitic nematodes have been obtained even when only fragments of ribosomal genes were used (Banna et al., 1997, Subbotin et al., 2001).

In this study we have evaluated the diagnostic utility of the ITS1 and ITS2 region for molecular identification and constructing phylogenetic trees and to see evolutionary relationship of plant parasitic nematodes from selected crops.

Materials and Methods

Selection of nematode collection sites and crops

This study was conducted in Muthireddy gudem of Ramannapet Mandal, Nalgonda District in Andhra Pradesh State during 2008-2011. Cotton crop field selected for the present study and sampling was done from each crop separately. Soil and plant samples were brought to the laboratory, in order to identify nematodes and maintained in laboratory conditions for extraction, counting, fixation and preservation of the phytonematodes. The nematodes were extracted with Cobb’s sieving and decanting gravity method (Cobb, 1918), fixed in FAA, processed to glycerin and mounted on slides for compound microscopic studies.

DNA isolation, PCR amplification and sequencing

Identification of nematodes to the species level often requires detailed morphological analysis, growth of the nematode on different host plants, or DNA analysis. The samples were electrophoresed on 1% Agarose gel using buffer 1X TAE. For reference λ-Hind III Digest was loaded along the sides of the samples. For analysis 2 μl of DNA sample was taken and 6 μl of 6x Gel loading dye was added and loaded to the Agarose gel. The concentration of 10-12 ng/μl is realized through above methods using standard concentration of λ DNA which is realized for further process such as PCR and sequencing. The entire genome DNA extracted from nematodes was directly amplified. The ITS containing region spanning from the 3´end of the 18S rDNA to the 5´end of the 28S rDNA was amplified using Forward primer 18S/rDNA1 (5ˈTTGATTACGTCCCTGCCCTTT3ˈ) and Reverse primer 26S/rDNA2 (5ˈTTTCACTCGCCGTTACTAAGG3ˈ). PCR amplification was carried out in 2 μl containing 2.5 mM of each dNTP, 1μl (10 pm/μl) of each primer and 1 unit of Taq DNA polymerase (1U/1 μl). PCR cycles consisted of an initial denaturation step at 95°C for 5 min, followed by 35 cycles of 50 sec at 95°C (denaturation), 1 min at 55 °C (annealing), 1 min at 72°C (elongation) and a final step at 72°C for 7 min

The size of amplification products was determined by comparison with the molecular weight marker Ladder 100 bp (Fermentas , St. Leon-Rot Germany) following electrophoresis of 10 μl on a 1% agarose gel. Ten μl of each PCR product was directly digested with the restriction enzymes: λ-Hind III (according manufacturer’s instructions in a total volume of 20 μl). The digestions were conducted overnight or for 4hrs at 37°C. The resulting DNA fragments were separated by gel electrophoresis in a 1% agarose gel. The gels were then observed using UV light. The amplified fragments from nematodes were isolated from agarose gel using mdi Micro GEL extraction kit. The quality of the sequences produced was checked using Sequence Navigator Software (Applied Bio-systems, Warrington, UK).

Phylogenetic analysis were conducted using MEGA 4.0 (Molecular Evolutionary Genetics Analysis) Software, taking above Clustal X2 Alignment File, Convert into MEGA Format, Then calculate distances and finally Predict Bootstrap of Phylogeny tree of Algorithms like Neighbour Joining. Neighbor Joining (NJ) this is a method often used to construct phylogenetic trees (Li, 1981; Faith, 1985). Neighbor joining is a special example of star decomposition method. In this method, the phylogenetic tree is constructed from a star-like tree by grouping OTUs with shortest distance of branch length together. This method is very suitable with dataset consisting descendants with largely varying rates of evolution. This method was discovered by Saitou and Nei (Saitou and Nei ,1987). The bootstrap analysis strongly supports the relationship between the organisms used in the study.

Results

Reniform nematode (Rotylenchulus reniformis) is widely distributed in all cotton (Gossypium spp.) grown regions of India. In Reniform nemotode infection, the growth of cotton roots and shoots was reduced at level of more than 8 and 1 nematode per g soil, respectively.

Rotylenchulus reniformis (Cotton) ITS1 and ITS2 gene sequence studies

Rotylenchulus reniformis is a phytonematode and a pest on Cotton crop. We isolated ITS1 and ITS2 gene sequence of rDNA. The sequence length was 882bp and the number of Adenine’s were 186, Cytosine’s were 258, Guanine’s were 260 and Thymidin’s were 178. The rDNA gene sequence annotation is as follows (Figure 1).

Figure 1: Rotylenchulus reniformis ITS2 gene Annotation

The amplification of the ITS region using primer pair Nem_18S_F/rDNA1, Nem_26S_R /rDNA2 yielded one distinct amplicon which was approximately 882 bp in size for the plant parasitic nematode (PPN) Rotylenchulus reniformis. The amplified PCR product of rDNA region included the size of 5.8S rDNA ranged 577 to 601bp, the size of ITS2 ranged from 602 to 832 bp and the size of 28S rDNA ranged from 833 to 857 bp. The average nucleotide composition of ITS region was 186 A's, 258 C's, 260 G's and 178 U/T's.

Phylogenetic analyses

Rotylenchulus reniformis was collected from soil and root samples of Cotton crop and from Rotylenchulus reniformis (PPN) the ITS region of rDNA sequence is isolated (Figure 2).

Figure 2: Multiple sequence alignment of ITS gene sequences of Rotylenchulus reniformis plant parasitic nematodes with similar plant parasitic nematode of ITS gene sequences using Clustal X2 * shows conserved nucleotides of all sequences.

Neighbor joining (NJ)

Neighbor joining is distance based method. Phylogenetic analyses of Rotylenchulus reniformis ITS region of rDNA sequence is belongs to the Rotylenchulidae family. This sequence depicted similarity with same family of nematodes such as Rotylenchulidae. In this NJ tree mainly two clades were formed. In the first clade Paratrichodorus sp of China country and Radopholus similis of Malaysia country were formed and in this Paratrichodorus poruses, Paratrichodorus renifer and Paratrichodorus minor were formed as sister nodes. In the second clade our sequence Rotylenchulus reniformis and Rotylenchulus reniformis of USA country were formed. Rotylenchulus reniformis of ITS gene sequence depicting high congruence with Rotylenchulus reniformis of USA country by 100 bootstrap replicate values (Figure 3).

Figure 3: Phylograms depicting the degree of relationship of rDNA region of ITS gene sequence of Rotylenchulus reniformis with other nematode ITS gene sequences using Algorithms of Neighbor Joining.

Discussion

Rotylenchulus reniformis is widely distributed in all cotton grown regions of India (Gulsar Banu, 2007). Rotylenchulus reniformis was first described from Hawaii, USA and is widespread in the tropics and subtropics (Stephen et al., 1991). About 19 Genera of plant parasitic nematodes are reported in cotton crop and in world until today (Nandini Gokte- Narkhedkar et a.l, 2002). Of these, the most important generic species in Indian context is Rotylenchulus reniformis (Reniform nematode), Meloidogyne incognita, Hoplolaimus sp. and Pratylenchus sp. The Rotylenchulus reniformis (Reniform nematode) has been recorded to be the key nematode species on cotton in Central and Southern India while in Northern cotton-growing areas, the Meloidogyne incognita (Root knot nematode) is dominant (Nandini Gokte et al., 2002).

In any organism the nucleotide base sequence is the primary source of biological variation (Powers et al., 1997). DNA bar coding method DNA sequences as markers for taxonomic identification and helps in biodiversity surveys (Hebert et al., 2003). The techniques what we used especially universal primers are fundamentally target microbial genes have significant advantages, e.g., convenience, high-throughput, and considerable savings in time (Puitika et al., 2007); It is a quicker and more efficient way of studying nematode diversity than traditional taxonomic methods, which depend on morphological criteria (Floyd et al., 2002). Knowledge of genetic diversity in the case of plant-parasitic nematodes is essential in breeding plants with high resistance in host plants an ecologically very important method of pest nematode control (Hahn et al., 1994; Roberts, 2002).

In this, we were used a single universal forward primer and reverse primers set Nem_18S_F/rDNA1, Nem_26S_R / rDNA2 to amplify all the target species of single nematode in a single tube, which was formed successful PCR bands on the agarose gel for the tested nematode samples. The use of multiplex reactions intensity bands in the PCR products helped to detect species of nematodes. Similarly, Floyd et al. (Floyd et al., 2005) also noticed and reported that the sensitivity of universal (Forward and Reverse) primer set gives it the ability to identify a mixed nematode population when only one nematode individual is taken for study.

By using our experimental genetic data we determined the molecular phylogeny of different nematode species based on sequence of ribosomal internal transcribed spacer (ITS) region (Strimmer and Haeseler, 1996; Ronquist and Huelsenbeck 2003; Kumar et al., 2004). Phylogeny is the history of organism lineage as they change through time. It implies that different species arise from previous forms via decent and that all organisms from the smallest microbes to the largest plants and vertebrates were connected by the passage by genes along the branches of the phylogenetic tree that links all the life form.

Plant parasitic nematode Rotylenchulus reniformis was isolated from Cotton field and it’s ITS sequence was obtained. In phylogenetic analyses Rotylenchulus reniformis showed similarities with Rotylenchulus reniformis (GI 398025668) of USA. In these analyses our sequence formed a clade with Rotylenchulus reniformis of USA. These species belongs to the same family Rotylenchulidae. It showed high similarity in these analyses of Neighbor Joining and Maximum parsimony and ITS sequence had formed a clade with different bootstrap replicate values (Figure 3).

Overall, the ITS region becomes an important taxonomic feature in nematode identification. ITS versatility, specificity, effort of experimental manipulation, and growing ITS databases should accelerate its application in nematology. Its usefulness, however, will hinge on a careful evaluation of the relationship between ITS genetic variation and traditional taxonomic positions in the coming days. Moreover, even minor variation that one noticed at ITS gene sequence may help in detecting ecotypes or the future evolutionary predictions with reference to that particular nematode species.

Most interesting finding in our studies with reference to plant parasitic nematode and its host plant suggested that ITS gene sequence helps in identifying nematode pest status and host plant susceptibility. Thus, these studies will help us to develop the Integrated Pest Management (IPM) package for a specific host plant and its variety. At the same time ITS supports Quarantine technology with reference to agro product export and import.

References

1. Atighi, M. R., Pourjam, E., Pedram, M., Cantalapiedra- Navarrete, C., Palomares-Rius, J. E. and Castillo, P., 2012. Molecular and morphological characterizations of two new Rotylenchus species from Iran. Nematology 13, 951-964.
2. Banna, L. Al., Williamson, V. and Gardner, S. L., 1997. Phylogeneti analysis of nematodes of the genus Pratylenchus using nuclear 26S rDNA, Mol. Phylogene. Evol. 7: 94-102.
3. Cantalapiedra-Navarrete, C., Liebanas, G., Archidona-Yuste, A., Palomares-Rius, J. E. and Castillo, P., 2012. Molecular and morphological characterizations of Rotylenchus vitis. (Nematoda: Hoplolaimidae) infecting grapevine in southern Spain. Nematology 14: 235-247.
4. Cobb, N. A., 1918. Estimating the Nema population of soil. USDA Agric. Tech. Circ. Bur. P1. Ind. U.S. Dep. Agric. 1: 48.
5. Floyd, R., Abebe, E., Papert, A. and Blaxter, M., 2002. Molecular barcodes for soil nematode identification. Mol. Ecol. 11: 839-850.
6. Floyd, R. M., Rogers, A. D., Lambshead, P. J. D. and Smith, C. R., 2005. Nematode specific PCR primers for the 18S small subunit rRNA gene. Mol. Ecol. Note. 5: 611-612.
7. Giorgi, C. D., Veronico, P., De Luca, F., Natilla, A., Lanave, C. and Pesole, G., 2002. Structural and evolutionary analysis of the ribosomal genes of the parasitic nematode Meloidogyne artiellia suggests its ancient origin. Mol. Biochem. Parasitol. 124: 91-94
8. Gulsar Banu, J., 2007. Nematode Pests of Cotton, Central Institute for Cotton Research, Regional Station, Coimbatore-641003.
9. Hahn, M. L., Burrows, P. R., Nalini, C. G., Bridge, J., Vines, N. J. and Wright, D. J., 1994. Molecular diversity amongst Radopholus similis populations from Sri Lanka Detected by RAPD analysis. Fund. Appl. Nematol. 17: 275-81.
10. Hebert, P. D., Cywinska, A., Ball, S. L. and deWaard, J. R., 2003. Biological identifications through DNA barcodes. Proc. Biol. Sci. 270: 313-321.
11. Kumar, S., Tamura,K. and Nei. M., 2004. MEGA3: Integrated software for Molecular Evolutionary Genetics Analysis and sequence alignment. Brief.  Bioinforma. 5: 150 163.
12. Li, W. H. 1981. Simple method for constructing phylogenetic trees from distance matrices. Proc. Natl. Acad. Sci. USA 78: 1085-1089.
13. Maggenti, A. R., 1991. General nematode morphology. In: W.R., Nickel (Edn.) Manual of Agricultural Nematology. Marcel Dekker, New York, USA, pp: 1-46.
14. Mai, W. F. and Mullin, P.G., 1996. Plant parasitic nematode. A pictorial key to genera, (5th Edn) Cornell University Press, Ithaca, New York, USA.
15. Nandini Gokte-Narkhedkar, P. M., Mukewar and Mayee. C. D., 2002. Technical, Bulletin No. 20, Central Institute for Cotton Research, Nagpur, India.
16. Powers, T. O, Todd, T.C, Burnell, A. M., Murray, P. C. and Fleming, C.C., 1997. The rDNA internal transcribed spacer region as a taxonomic marker for nematodes. J. Nematol. 29: 441-450.
17. Puitika, T., Kasahara, Y., Miyoshi, N., Sato, Y. and Shimano, S., 2007. A Taxon specific oligonucleotide primer set for PCR-based detection of soil ciliate. Microbes Environ 22: 78-81.
18. Roberts, P.A., Starr, J. L., Cook, R. and Bridge, J., 2002. Concepts and consequences of resistance. In: Plant Resistance to Parasitic Nematodes. CABI, New York,  USA, pp: 23-41.
19. Ronquist, F., Huelsenbeck, J. P. and Bayes M.,  2003. 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19: 1572-1574.
20. Saitou, N. and Nei, M., 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4: 406-425.
21. Stephen, A. F. and Rebecca, A. B., 1991. Extension Plant Pathologist, Educational Specialist, Department of Plant Pathology,CTAHR, University of Hawaii at Manoa, 2A ROREN.
22. Strimmer, K. and Von Haeseler, A., 1996. Quartet puzzling: A quartet maximum likelihood method for reconstructing tree topologies. Mol. Biol. Evol. 13: 964-969.
23. Subbotin, S. A., Halford, P. D., Warry, A. and Perry, R.N., 2000. Variations in ribosomal DNA sequences and phylogeny of Globodera parasiting Solana ceousplants. Nematology. 2: 591-604.
24. Vovlas, N., Nico, A. I., Deluca, F., De Giorgi, C. and Castillo, P., 2007. Diagnosis and molecular variability of an argentinean population of Nacobbus aberrans with some observations on histopathology in tomato. J. Nematol. 39: 17-26.
25. Vrain, T. C., Wakarchuk, D. A., Levesque, A. C. and Hamilton, R. I., 1992. Intraspecific rDNA restriction fragment length polymorphism in the Xiphinema americanum group. Fund. Appl. Nematol. 15: 563-573.